Indices¶
- Learning Objective
- You will get an overview of the different kinds of indices in SeqAn and how they are used.
- Difficulty
- Average
- Duration
- 1 h
- Prerequisites
- Sequences
Indices in SeqAn¶
Indices in SeqAn are substring indices, meaning that they allow efficient pattern queries in strings or sets of strings. In contrast to, e.g., online-search algorithms that search through the text in \(\mathcal{O}(n)\), substring indices find a pattern in sublinear time \(o(n)\).
You can find the following indices in SeqAn.
- IndexSa
- Suffix Array [MM93]
- IndexEsa
- Extended Suffix Array [AKO04]
- IndexWotd
- Lazy suffix tree [GKS03]
- IndexDfi
- Deferred Frequency Index [WS08]
- IndexQGram
- Q-gram index
- PizzaChiliIndex
- An adapter for the Pizza & Chili index API
- FMIndex
- Full-text minute index [FM01]
Index Construction¶
We will now show how we can create the different indices in SeqAn before we show how they are used for pattern search.
All the mentioned indices belong to the generic Index class. A SeqAn index needs two pieces of information: the type of the String or StringSet to be indexed and the index specialization, such as IndexEsa or FMIndex.
The following code snippet creates an enhanced suffix array index of a string of type Dna5.
String<Dna5> genome = "ACGTACGTACGTN";
Index<String<Dna5>, IndexEsa<> > esaIndex(genome);
In contrast, the next code snipped creates a FM index over a set of amino acid sequences:
StringSet<String<AminoAcid> > protein;
appendValue(protein, "VXLAGZ");
appendValue(protein, "GKTVXL");
appendValue(protein, "XLZ");
Index<StringSet<String<AminoAcid> >, FMIndex<> > fmIndex(protein);
Assignment 1¶
- Type
- Review
- Objective
Copy the code below and
- change it to build an IndexEsa over a string of type Dna,
- add an IndexEsa over a StringSet of Strings of type Dna.
#include <seqan/sequence.h> #include <seqan/index.h> using namespace seqan; int main() { String<char> text = "This is the first example"; Index<String<char>, FMIndex<> > index(text); return 0; }
- Solution
#include <seqan/sequence.h> #include <seqan/index.h> using namespace seqan; int main() { // One possible solution to the first sub assignment String<Dna> text = "ACGTTTGACAGCT"; Index<String<Dna>, IndexEsa<> > index(text); // One possible solution to the second sub assignment StringSet<String<Dna> > stringSet; appendValue(stringSet, "ACGTCATCAT"); appendValue(stringSet, "ACTTTG"); appendValue(stringSet, "CACCCCCCTATTT"); Index<StringSet<String<Dna> >, IndexEsa<> > indexSet(stringSet); return 0; }
Index Based Pattern Search (Strings)¶
SeqAn provides two methods for searching for a pattern in index structures. One method uses iterators and is similar to traversing search trees or tries. The tutorial Index Iterators explains this method in more detail. In this section you will learn how to find a pattern with the Finder interface.
The Finder is an object that stores all necessary information for searching for a pattern using an index. The following line of code shows how the Finder is initialized.
String<Dna5> genome = "ACGTACGTACGTN";
Index<String<Dna5>, IndexEsa<> > esaIndex(genome);
Finder<Index<String<Dna5>, IndexEsa<> > > esaFinder(esaIndex);
After initialization it is possible to use the find function in order to trigger a search for all occurrences of a given pattern in the underlying String or StringSet.
In this example, we search for the pattern ACGT:
find(esaFinder, "ACGT");
Calling the function find invokes the localization of all occurrences of a given pattern.
It works by modifying pointers of the Finder to tables of the index.
For example, the Finder of esaIndex stores two pointers, pointing to the first and last suffix array entry that stores an occurrence of the pattern.
The return value of the find function tells us whether or not a given pattern occurs in the text. Furthermore, if there are several instances of a pattern, consecutive calls of find will modify the Finder such that it points to the next occurrence after each call:
find(esaFinder, "ACGT"); // first occurrence of "ACGT"
find(esaFinder, "ACGT"); // second occurrence of "ACGT"
find(esaFinder, "ACGT"); // third occurrence of "ACGT"
The above code is not very useful, since we do not know the locations of the first, second or third pattern occurrence.
The function position will help here.
position called on a finder returns the location of the xth pattern, where x can be the first, second, or any other occurrence of the pattern.
find(esaFinder, "ACGT"); // first occurrence of "ACGT"
position(esaFinder); // -> 0
find(esaFinder, "ACGT"); // second occurrence of "ACGT"
position(esaFinder); // -> 4
find(esaFinder, "ACGT"); // third occurrence of "ACGT"
position(esaFinder); // -> 8
Tip
Indices in SeqAn are build on demand. That means that the index tables are not build when the constructor is called, but when we search for a pattern for the first time.
Assignment 2¶
- Type
- Application
- Objective
- Write a small program that prints the locations of all occurrences of
"TATAA"in"TTATTAAGCGTATAGCCCTATAAATATAA". - Hints
- Use the find function as the conditional instruction of a <tt>while</tt> loop.
- Solution
#include <seqan/sequence.h> #include <seqan/index.h> using namespace seqan; int main() { String<Dna5> genome = "TTATTAAGCGTATAGCCCTATAAATATAA"; Index<String<Dna5>, IndexEsa<> > esaIndex(genome); Finder<Index<String<Dna5>, IndexEsa<> > > esaFinder(esaIndex); while (find(esaFinder, "TATAA")) { std::cout << position(esaFinder) << std::endl; } return 0; }
You might have noticed that we only applied the FMIndex and IndexEsa in the examples. The reason for this is that even though everything stated so far is true for the other indices as well, IndexWotd and IndexDfi are more usefull when used with iterators as explained in the tutorial Index Iterators and the IndexQGram uses Shapes which is also explained in another tutorial.
One last remark is necessary.
Handling Multiple Sequences (StringSets)¶
The previous sections already described how an index of a set of strings can be instantiated. A character position of a StringSet can be one of the following:
- A local position (default), i.e. a Pair (seqNo, seqOfs) where seqNo identifies the string within the StringSet and the seqOfs identifies the position within this string.
- A global position, i.e. a single integer value between 0 and the sum of string lengths minus 1. This integer is the position in the gapless concatenation of all strings in the StringSet to a single string.``
For indices, the meta-function SAValue determines, which position type (local or global) will be used for internal index tables (suffix array, q-gram array) and what type of position is returned by functions like position of a Finder. SAValue returns a Pair (local position) by default, but could be specialized to return an integer type (global position) for some applications. If you want to write algorithms for both variants you should use the functions posLocalize, posGlobalize, getSeqNo, and getSeqOffset.
Storing and Loading¶
Storing and loading an index can be done with:
const char * tempFileName = SEQAN_TEMP_FILENAME();
save(index, tempFileName);
or
open(index, tempFileName);
If you have built your q-gram index with variable shapes (i.e. SimpleShape GenericShape), you have to keep in mind that q or the shape is not stored or loaded. This must be done manually directly before or after loading with resize oder stringToShape.
A newly instantiated index is initially empty. If you assign a text to be indexed, solely the text fibre is set. All other fibres are empty and created on demand. Normally, a full created index should be saved to disk. Therefore, you have to create the required fibres explicitly by hand.
indexRequire(index, FibreSA());
For the IndexEsa index you could do:
indexRequire(esaIndex, EsaSA());
indexRequire(esaIndex, EsaLcp());
indexRequire(esaIndex, EsaChildtab()); // for TopDown iterators
indexRequire(esaIndex, EsaBwt()); // for (Super-)MaxRepeats iterators
Indexes based on external strings, e.g. Index<String<Dna,External<> >,IndexEsa<> > or Index<String<Dna,MMap<> >,IndexEsa<> > cannot be saved, as they are persistent implicitly.
The first thing after instantiating such an index should be associating it to a file with:
Index<String<Dna, External<> >, IndexEsa<> > external_index;
open(external_index, tempFileName);
The file association implies that any change on the index, e.g. fibre construction, is synchronized to disk. When instantiating and associating the index the next time, the index contains its previous state and all yet constructed fibres.
Reducing the memory consumption¶
All Indices in SeqAn are capable of indexing Strings or StringSets of arbitrary sizes, i.e. up to 2^64 characters. This always comes at a cost in terms of memory consumption, as any Index has to represent 64 bit positions in the underlying text. However, in many practical instances, the text to be indexed is shorter, e.g. it does not exceed 4.29 billion (2^32) characters. In this case, one can reduce the memory consumption of an Index by changing its internal data types, with no drawback concerning running time.
SA Fibre¶
All Indices in SeqAn internally use the FibreSA, i.e. some sort of suffix array. For Strings, each suffix array entry consumes 64 bit of memory per default, where 32 bit would be sufficient if the text size is appropriate. In order to change the size type of the suffix array entry we simply have to overload the metafunction SAValue.
template<>
struct SAValue<String<Dna> >
{
typedef unsigned Type;
};
If your text is a StringSet, then SAValue will return a Pair that can be overloaded in the same way.
template<>
struct SAValue<StringSet<String<Dna> > >
{
typedef Pair<unsigned, unsigned> Type;
};
The first type of the pair is used as the type for the index of a string in the string set. So if you only have a few strings you could save even more memory like this.
typedef Pair<unsigned char, unsigned> Type;
FMIndex Fibres¶
The size of a generalized FMIndex depends also on the total number of characters in a StringSet (see lengthSum). This trait can be configured via the FMIndexConfig object.
typedef FMIndexConfig<void, unsigned> TConfig;
Index<StringSet<String<Dna> >, FMIndex<void, TConfig> > configIndex(set);
Other Index Fibres¶
See Accessing Index Fibres for more information.