String Sets¶
- Learning Objective
- You will learn the advantages of StringSets and how to work with them.
- Difficulty
- Basic
- Duration
- 15 min
- Prerequisites
- Sequences
A set of sequences can either be stored in a sequence of sequences, for example in a String<String<char> >, or in a StringSet.
This tutorial will introduce you to the SeqAn class StringSet, its background and how to use it.
Background¶
One advantage of using StringSet is that it supports the function concat that returns a concatenator of all sequences in the string set. A concatenator is an object that represents the concatenation of a set of strings. This way, it is possible to build up index data structures for multiple sequences by using the same construction methods as for single sequences.
There are two kinds of StringSet specializations in SeqAn: Owner StringSet, the default specialisation, and Dependent StringSet; see the list below for details. Owner StringSets actually store the sequences, whereas Dependent StringSets just refer to sequences that are stored outside of the string set.
StringSet<DnaString> ownerSet;
StringSet<DnaString, Owner<> > ownerSet2; // same as above
StringSet<DnaString, Dependent<> > dependentSet;
The specialization ConcatDirecet StringSet already stores the sequences in a concatenation. The concatenators for all other specializations of StringSet are virtual sequences, that means their interface simulates a concatenation of the sequences, but they do not literally concatenate the sequences into a single sequence. Hence, the sequences do not need to be copied when a concatenator is created.
One string can be an element of several Dependent StringSets.
Typical tasks are, e.g., to find a specific string in a string set, or to test whether the strings in two string sets are the same.
Therefore a mechanism to identify the strings in the string set is needed, and, for performance reasons, this identification should not involve string comparisons.
SeqAn solves this problem by introducing ids, which are by default unsigned int values.
The following list lists the different StringSet specializations:
- Specialization
Owner<ConcatDirect> - The sequences are stored as parts of a long string. Since the sequences are already concatenated, concat just needs to return this string. The string set also stores lengths and starting positions of the strings. Inserting new strings into the set or removing strings from the set is more expensive than for the default OwnerStringSet specialization, since this involves moving all subsequent sequences in memory.
- Specialization
Dependent<Tight> - This specialization stores sequence pointers consecutively in an array. Another array stores an id value for each sequence. That means that accessing given an id needs a search through the id array.
- Specialization
Dependent<Generous> - The sequence pointers are stored in an array at the position of their ids.
If a specific id is not present, the array stores a zero at this position.
The advantage of this specialization is that accessing the sequence given its id is very fast.
On the other hand, accessing a sequence given its position
ican be expensive, since this means we have to find the i-th non-zero value in the array of sequence pointers. The space requirements of a string set object depends on the largest id rather than the number of sequences stored in the set. This could be inefficient for string sets that store a small subset out of a large number of sequences.
Building String Sets¶
Use the function appendValue to append strings to string sets.
#include <seqan/sequence.h>
#include <seqan/stream.h>
using namespace seqan;
int main()
{
StringSet<DnaString> stringSet;
DnaString str0 = "TATA";
DnaString str1 = "CGCG";
appendValue(stringSet, str0);
appendValue(stringSet, str1);
Functionality¶
This section will give you a short overview of the functionality of the class StringSet.
There are two ways for accessing the sequences in a string set: (1) the function value returns a reference to the sequence at a specific position within the sequence of sequences, and (2) valueById accesses a sequence given its id. We can retrieve the id of a sequence in a StringSet with the function positionToId.
// (1) Access by position
std::cout << "Owner: " << '\n';
std::cout << "Position 0: " << value(stringSet, 0) << '\n';
// Get the corresponding ids
unsigned id0 = positionToId(stringSet, 0);
unsigned id1 = positionToId(stringSet, 1);
// (2) Access by id
std::cout << "Id 0: " << valueById(stringSet, id0) << '\n';
std::cout << "Id 1: " << valueById(stringSet, id1) << '\n';
return 0;
}
Owner:
Position 0: TATA
Id 0: TATA
Id 1: CGCG
In the case of Owner StringSets, id and position of a string are always the same, but for Dependent StringSets, the ids can differ from the positions. For example, if a Dependent StringSet is used to represent subsets of strings that are stored in Owner StringSets, one can use the position of the string within the Owner StringSet as id of the strings. With the function assignValueById, we can add the string with a given id from the source string set to the target string set.
// Let's create a string set of type dependent to represent strings,
// which are stored in the StringSet of type Owner
StringSet<DnaString, Dependent<Tight> > depSet;
// We assign the first two strings of the owner string set to the dependent StringSet,
// but in a reverse order
assignValueById(depSet, stringSet, id1);
assignValueById(depSet, stringSet, id0);
std::cout << "Dependent: " << '\n';
// (1) Access by position
std::cout << "Pos 0: " << value(depSet, 0) << '\n';
// (2) Access by id
std::cout << "Id 0: " << valueById(depSet, id0) << '\n';
Dependent:
Pos 0: CGCG
Id 0: TATA
With the function positionToId we can show that, in this case, the position and the id of a string are different.
std::cout << "Position 0: Id " << positionToId(depSet, 0) << '\n';
std::cout << "Position 1: Id " << positionToId(depSet, 1) << '\n';
Position 0: Id 1
Position 1: Id 0
Iterating over String Sets¶
As well as for other containers, SeqAn has implemented iterators for StringSets. The generall usage of iterators is described in the tutorial Iterators. The following example illustrates, how to iterate over the StringSet.
typedef Iterator<StringSet<DnaString> >::Type TStringSetIterator;
for (TStringSetIterator it = begin(stringSet); it != end(stringSet); ++it)
{
std::cout << *it << '\n';
}
TATA
CGCG
If we want to iterate over the contained Strings as well, as if the StringSet would be one sequence, we can use the function concat to get the concatenation of all sequences. Therefore we first use the metafunction Concatenator to receive the type of the concatenation. Then, we can simply build an iterator for this type and iterate over the concatenation of all strings.
typedef Concatenator<StringSet<DnaString> >::Type TConcat;
TConcat concatSet = concat(stringSet);
Iterator<TConcat>::Type it = begin(concatSet);
Iterator<TConcat>::Type itEnd = end(concatSet);
for (; it != itEnd; goNext(it))
{
std::cout << getValue(it) << " ";
}
std::cout << '\n';
T A T A C G C G
Assignment 1¶
- Type
- Review
- Objective
- Build a string set with default specialization and which contains the strings
"AAA","CCC","GGG"and"TTT". After that print the length of the string set and use a simple for-loop to print all elements of the strings set. - Solution
Click more... to see the solution.
#include <iostream> #include <seqan/sequence.h> #include <seqan/stream.h> using namespace seqan; int main() { // Build strings DnaString str0 = "AAA"; DnaString str1 = "CCC"; DnaString str2 = "GGG"; DnaString str3 = "TTT"; // Build string set and append strings StringSet<DnaString> stringSet; appendValue(stringSet, str0); appendValue(stringSet, str1); appendValue(stringSet, str2); appendValue(stringSet, str3); // Print the length of the string set std::cout << length(stringSet) << std::endl; // Print all elements for (unsigned i = 0; i < length(stringSet); ++i) { std::cout << stringSet[i] << std::endl; } return 0; }
Assignment 2¶
- Type
- Application
- Objective
In this task you will test, whether a Dependent StringSet contains a string without comparing the actual sequences. Use the given code frame below and adjust it in the following way:
- Build a Owner StringSet to store the given strings.
- Get the corresponding ids for each position and store them.
- Build a DependentStringSet and assign the strings of the owner string set from position 0,1 and 3 by their id to it.
- Write a function
isElementwhich takes aStringSet<Dependent<> >and aIdas arguments and checks whether a string set contains a string with a given id.- Check if the string set contains the string of position
3and2and print the result.#include <iostream> #include <seqan/sequence.h> #include <seqan/file.h> using namespace seqan; int main() { // Build strings DnaString str0 = "TATA"; DnaString str1 = "CGCG"; DnaString str2 = "TTAAGGCC"; DnaString str3 = "ATGC"; DnaString str4 = "AGTGTCA"; // Your code return 0; }
- Hints
- You can use the SeqAn functions positionToId and assignValueById.
- Solution
Click more... to see the solution.
#include <iostream> #include <seqan/sequence.h> #include <seqan/stream.h> using namespace seqan; // Check whether the string set contains the string with the given id, // without comparing the actual sequences template <typename TStringSet, typename TId> bool isElement(TStringSet & stringSet1, TId & id) { for (unsigned i = 0; i < length(stringSet1); ++i) { // Get the id of the element at position i if (positionToId(stringSet1, i) == id) return true; } return false; } int main() { // Build strings DnaString str0 = "TATA"; DnaString str1 = "CGCG"; DnaString str2 = "TTAAGGCC"; DnaString str3 = "ATGC"; DnaString str4 = "AGTGTCA"; // Build owner string set and append strings StringSet<DnaString> stringSetOw; appendValue(stringSetOw, str0); appendValue(stringSetOw, str1); appendValue(stringSetOw, str2); appendValue(stringSetOw, str3); appendValue(stringSetOw, str4); // Get corresponding ids for positions unsigned id0 = positionToId(stringSetOw, 0); unsigned id1 = positionToId(stringSetOw, 1); unsigned id2 = positionToId(stringSetOw, 2); unsigned id3 = positionToId(stringSetOw, 3); // Build dependent string set and assigns strings by id StringSet<DnaString, Dependent<Generous> > stringSetDep; assignValueById(stringSetDep, stringSetOw, id0); assignValueById(stringSetDep, stringSetOw, id1); assignValueById(stringSetDep, stringSetOw, id3); // Call function to check if a string is contained and output result std::cout << "Does the string set contain the string with the id 'id3'? " << isElement(stringSetDep, id3) << std::endl; std::cout << "Does the string set contain the string with the id 'id2'? " << isElement(stringSetDep, id2) << std::endl; return 0; }
Workshop Assignment 4¶
- Type
- Review
- Objective
In this assignment, we pick up the example from the workshop assignments from the sequences and iterators tutorials. Take the last solution and change the code to build and use StringSets.
- Build a StringSet of readList. Reuse the Rooted iterator above.
- Iterate over the StringSet and print out the values.
#include <iostream> #include <seqan/sequence.h> #include <seqan/stream.h> using namespace seqan; // Function to print simple alignment between two sequences with the same length template <typename TText1, typename TText2> void printAlign(TText1 const & genomeFragment, TText2 const & read) { std::cout << "Alignment " << std::endl; std::cout << " genome : " << genomeFragment << std::endl; std::cout << " read : " << read << std::endl; } int main(int, char const **) { // Build reads and genomes DnaString chr1 = "TATAATATTGCTATCGCGATATCGCTAGCTAGCTACGGATTATGCGCTCTGCGATATATCGCGCTAGATGTGCAGCTCGATCGAATGCACGTGTGTGCGATCGATTAGCGTCGATCATCGATCTATATTAGCGCGCGGTATCGGACGATCATATTAGCGGTCTAGCATTTAG"; // Build List containing all reads typedef String<DnaString> TDnaList; TDnaList readList; resize(readList, 4); readList[0] = "TTGCTATCGCGATATCGCTAGCTAGCTACGGATTATGCGCTCTGCGATATATCGCGCT"; readList[1] = "TCGATTAGCGTCGATCATCGATCTATATTAGCGCGCGGTATCGGACGATCATATTAGCGGTCTAGCATT"; readList[2] = "AGCCTGCGTACGTTGCAGTGCGTGCGTAGACTGTTGCAAGCCGGGGGTTCATGTGCGCTGAAGCACACATGCACA"; readList[3] = "CGTGCACTGCTGACGTCGTGGTTGTCACATCGTCGTGCGTGCGTACTGCTGCTGACA"; // Append a second chromosome sequence fragment to chr1 DnaString chr2 = "AGCCTGCGTACGTTGCAGTGCGTGCGTAGACTGTTGCAAGCCGGGGGTTCATGTGCGCTGAAGCACACATGCACACGTCTCTGTGTTCCGACGTGTGTCACGTGCACTGCTGACGTCGTGGTTGTCACATCGTCGTGCGTGCGTACTGCTGCTGACACATGCTGCTG"; append(chr1, chr2); // Print readlist std::cout << " \n Read list: " << std::endl; for (unsigned i = 0; i < length(readList); ++i) std::cout << readList[i] << std::endl; // Assume we have mapped the 4 reads to chr1 (and chr2) and now have the mapping start positions (no gaps). // Store the start position in a String alignPosList: 7, 100, 172, 272 String<unsigned> alignPosList; resize(alignPosList, 4); alignPosList[0] = 7; alignPosList[1] = 100; alignPosList[2] = 172; alignPosList[3] = 272; // Print alignments using Segment std::cout << " \n Print alignment using Segment: " << std::endl; for (unsigned i = 0; i < length(readList); ++i) { // Temporary copy of begin and end position (beginPosition) from alignPosList // of a given alignment between the read and the genome unsigned beginPosition = alignPosList[i]; unsigned endPosition = beginPosition + length(readList[i]); // Build infix Infix<DnaString>::Type genomeFragment = infix(chr1, beginPosition, endPosition); // Call of our function to print the simple alignment printAlign(genomeFragment, readList[i]); } // Iterators :) // Print alignments using Iterators: Do the same as above, but use Iterators to iterate over the read list. // First, use Standard Iterators. Iterator<TDnaList>::Type it = begin(readList); Iterator<TDnaList, Standard>::Type itEnd = end(readList); //same Iterator as above std::cout << " \n Print alignment using Standard Iterators: " << std::endl; for (; it != itEnd; goNext(it)) { // Get the right index for alignPosList int i = position(it, readList); // Temporary copy of begin and end position (beginPosition) from alignPosList // of a given alignment between the read and the genome unsigned beginPosition = alignPosList[i]; unsigned endPosition = beginPosition + length(value(it)); // Build Infix Infix<DnaString>::Type genomeFragment = infix(chr1, beginPosition, endPosition); // Call of our function to print the simple alignment printAlign(genomeFragment, value(it)); } // Now, use Rooted Iterators. Iterator<TDnaList, Rooted>::Type it2 = begin(readList); std::cout << " \n Print alignment using Rooted Iterators: " << std::endl; for (; !atEnd(it2); goNext(it2)) { int i = position(it2); // Temporary copy of begin and end position (beginPosition) from alignPosList // of a given alignment between the read and the genome unsigned beginPosition = alignPosList[i]; unsigned endPosition = beginPosition + length(value(it2)); // Build Infix Infix<DnaString>::Type genomeFragment = infix(chr1, beginPosition, endPosition); // Call of our function to print the simple alignment printAlign(genomeFragment, value(it2)); } return 0; }
- Solution
Click more... to see the solution.
#include <iostream> #include <seqan/sequence.h> #include <seqan/stream.h> using namespace seqan; // Function to print simple alignment between two sequences with the same length template <typename TText1, typename TText2> void printAlign(TText1 const & genomeFragment, TText2 const & read) { std::cout << "Alignment " << std::endl; std::cout << " genome : " << genomeFragment << std::endl; std::cout << " read : " << read << std::endl; } int main(int, char const **) { // Build reads and genomes DnaString chr1 = "TATAATATTGCTATCGCGATATCGCTAGCTAGCTACGGATTATGCGCTCTGCGATATATCGCGCTAGATGTGCAGCTCGATCGAATGCACGTGTGTGCGATCGATTAGCGTCGATCATCGATCTATATTAGCGCGCGGTATCGGACGATCATATTAGCGGTCTAGCATTTAG"; // Build List containing all reads typedef String<DnaString> TDnaList; TDnaList readList; resize(readList, 4); readList[0] = "TTGCTATCGCGATATCGCTAGCTAGCTACGGATTATGCGCTCTGCGATATATCGCGCT"; readList[1] = "TCGATTAGCGTCGATCATCGATCTATATTAGCGCGCGGTATCGGACGATCATATTAGCGGTCTAGCATT"; readList[2] = "AGCCTGCGTACGTTGCAGTGCGTGCGTAGACTGTTGCAAGCCGGGGGTTCATGTGCGCTGAAGCACACATGCACA"; readList[3] = "CGTGCACTGCTGACGTCGTGGTTGTCACATCGTCGTGCGTGCGTACTGCTGCTGACA"; // Append a second chromosome sequence fragment to chr1 DnaString chr2 = "AGCCTGCGTACGTTGCAGTGCGTGCGTAGACTGTTGCAAGCCGGGGGTTCATGTGCGCTGAAGCACACATGCACACGTCTCTGTGTTCCGACGTGTGTCACGTGCACTGCTGACGTCGTGGTTGTCACATCGTCGTGCGTGCGTACTGCTGCTGACACATGCTGCTG"; append(chr1, chr2); // Print readlist std::cout << " \n Read list: " << std::endl; for (unsigned i = 0; i < length(readList); ++i) std::cout << readList[i] << std::endl; // Assume we have mapped the 4 reads to chr1 (and chr2) and now have the mapping start positions (no gaps). // Store the start position in a String alignPosList: 7, 100, 172, 272 String<unsigned> alignPosList; resize(alignPosList, 4); alignPosList[0] = 7; alignPosList[1] = 100; alignPosList[2] = 172; alignPosList[3] = 272; // Print alignments using Segment std::cout << " \n Print alignment using Segment: " << std::endl; for (unsigned i = 0; i < length(readList); ++i) { // Temporary copy of begin and end position (beginPosition) from alignPosList // of a given alignment between the read and the genome unsigned beginPosition = alignPosList[i]; unsigned endPosition = beginPosition + length(readList[i]); // Build infix Infix<DnaString>::Type genomeFragment = infix(chr1, beginPosition, endPosition); // Call of our function to print the simple alignment printAlign(genomeFragment, readList[i]); } // Iterators :) // Print alignments using Iterators: Do the same as above, but use Iterators to iterate over the read list. // First, use Standard Iterators. Iterator<TDnaList>::Type it = begin(readList); Iterator<TDnaList, Standard>::Type itEnd = end(readList); //same Iterator as above std::cout << " \n Print alignment using Standard Iterators: " << std::endl; for (; it != itEnd; goNext(it)) { // Get the right index for alignPosList int i = position(it, readList); // Temporary copy of begin and end position (beginPosition) from alignPosList // of a given alignment between the read and the genome unsigned beginPosition = alignPosList[i]; unsigned endPosition = beginPosition + length(value(it)); // Build Infix Infix<DnaString>::Type genomeFragment = infix(chr1, beginPosition, endPosition); // Call of our function to print the simple alignment printAlign(genomeFragment, value(it)); } // Now, use Rooted Iterators. Iterator<TDnaList, Rooted>::Type it2 = begin(readList); std::cout << " \n Print alignment using Rooted Iterators: " << std::endl; for (; !atEnd(it2); goNext(it2)) { int i = position(it2); // Temporary copy of begin and end position (beginPosition) from alignPosList // of a given alignment between the read and the genome unsigned beginPosition = alignPosList[i]; unsigned endPosition = beginPosition + length(value(it2)); // Build Infix Infix<DnaString>::Type genomeFragment = infix(chr1, beginPosition, endPosition); // Call of our function to print the simple alignment printAlign(genomeFragment, value(it2)); } // StringSets // Build StringSet of readList: Build a StringSet of DnaQString and append the reads from readList. // Reuse the Rooted Iterator from above. typedef StringSet<DnaString> TDnaListSet; TDnaListSet readStringSet; goBegin(it2); for (; !atEnd(it2); goNext(it2)) appendValue(readStringSet, value(it2)); // Iterate over StringSet Iterator<TDnaListSet, Rooted>::Type it3 = begin(readStringSet); std::cout << " \n Print reads stored in a StringSet using Rooted Iterators: " << std::endl; for (; !atEnd(it3); goNext(it3)) std::cout << value(it3) << std::endl; return 0; }